![]() # enter sequence into the query field and hit 'blast' button to search # (first need to download Chrome webdriver, or a firefox webdriver, etc)ĭriver = webdriver.Chrome(executable_path=CHROME_WEBDRIVER_LOCATION) SEQUENCE = 'CCTAAACTATAGAAGGACAGCTCAAACACAAAGTTACCTAAACTATAGAAGGACAGCTCAAACACAAAGTTACCTAAACTATAGAAGGACAGCTCAAACACAAAGTTACCTAAACTATAGAAGGACAGCTCAAACACAAAGTTACCTAAACTATAGAAGGACA' #'GAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGA'ĬHROME_WEBDRIVER_LOCATION = '/home/max/Downloads/chromedriver' # update this for your machine Below is the code that gets me to the results I want: from selenium import webdriver I am using Python/Selenium to submit genetic sequences to an online database, and want to save the full page of results I get back.
0 Comments
Leave a Reply. |
AuthorWrite something about yourself. No need to be fancy, just an overview. ArchivesCategories |